View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10866_low_5 (Length: 204)
Name: NF10866_low_5
Description: NF10866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10866_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 28 - 176
Target Start/End: Original strand, 46635517 - 46635669
Alignment:
| Q |
28 |
gtatacttggtcttgatgtt----tatcatcctcgatggttagcaatcaacaacccttctgttatgctttgcttgtgataataacatatttcgtgtgctt |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46635517 |
gtatacttggtcttgatgtttgtttatcatcctcgaaggttagcaatcaacaacccttctgttatgctttgcttgtgataataacatatttcgtgtgctt |
46635616 |
T |
|
| Q |
124 |
aattcttttcactgtttgttctgtaatctttgtgttgttcatcaatgtctttg |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46635617 |
aattcttttcactgtttggtctgtaatctttgtgttgttcatcaatgtctttg |
46635669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University