View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10867_high_3 (Length: 312)
Name: NF10867_high_3
Description: NF10867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10867_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 13 - 296
Target Start/End: Complemental strand, 37671937 - 37671654
Alignment:
| Q |
13 |
cagatgataaacgatttctgcagagatatttaaaatgtcggggcgtaagttcaaactcgcaatattaagaatatactaactgattttggttgtgattttc |
112 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37671937 |
cagatgataaacaattgctgcagagatatttaaaatgtcggggcgtaagttcaaactcgcaatattaagaatatactaactgattttggttgtgattttc |
37671838 |
T |
|
| Q |
113 |
ttttggatgatgatctggttgaggaagaagcagaatctgatagaagatactcttgcattatccaattggtttgattaccattaggtgcttctccaatatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37671837 |
ttttggatgatgatctggttgaggaagaagcagaatctgatagacgatactcttgcattatccaattggtttgattaccattaggtgcttctccaatatg |
37671738 |
T |
|
| Q |
213 |
gaacacataatatttcttcataccaactctcttattgcttgagcttgttacaacttgttcttccattcccattggcatccaata |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37671737 |
gaacacataatatttcttcataccaactctcttattgcttgagcttgttacaacttgttcttccattcccattggcatccaata |
37671654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University