View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10867_low_1 (Length: 411)
Name: NF10867_low_1
Description: NF10867
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10867_low_1 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 4e-82; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 69 - 260
Target Start/End: Original strand, 7896294 - 7896477
Alignment:
| Q |
69 |
agagaagggagtgaatagcaaagtggggccaccgcttggaaagaagggttgtcatgaaagcttgtttaatcgaaagaaatgagagtatgtgtctatgtga |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7896294 |
agagaagggagtgaatagcaaagtggggccaccgcgtggaaagaagggttgtcatgaaagcttgtttaatcgaaagaaatgagagtatg--------tga |
7896385 |
T |
|
| Q |
169 |
cacaacaattcatctgacaaaccactgattccatcgaccaaactatttctgccatcacagggagcatcataattcacctaaaacatacaaat |
260 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896386 |
cacaacaattcatctggcaaaccactgattccatcgaccaaactatttctgccatcacagggagcatcataattcacctaaaacatacaaat |
7896477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 354 - 395
Target Start/End: Original strand, 7896601 - 7896642
Alignment:
| Q |
354 |
ttattacggaatatatcggtgctctttcttctcagatgctct |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896601 |
ttattacggaatatatcggtgctctttcttctcagatgctct |
7896642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 11 - 52
Target Start/End: Original strand, 7896222 - 7896263
Alignment:
| Q |
11 |
caaagggttaagaaaataacagttatcaaaatatatgaagga |
52 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7896222 |
caaagggttaagaaaataacatttatcaaaatatatgaagga |
7896263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 7871335 - 7871279
Alignment:
| Q |
74 |
agggagtgaatagcaaagtgggg-ccaccgcttggaaagaagggttgtcatgaaagc |
129 |
Q |
| |
|
||||||||||||||| |||||| |||||| ||||||||||||||||| ||||||| |
|
|
| T |
7871335 |
agggagtgaatagcatagtgggatccaccgtttggaaagaagggttgtagtgaaagc |
7871279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University