View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10868_low_17 (Length: 270)
Name: NF10868_low_17
Description: NF10868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10868_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 37 - 94
Target Start/End: Original strand, 35653214 - 35653271
Alignment:
| Q |
37 |
gggtgccctatgaggtattccctttcttcttgaatttggcttttggataggaagcatg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35653214 |
gggtgccctatgaggtattccctttcttcttgaatttggcttttggataggaagcatg |
35653271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 213 - 258
Target Start/End: Original strand, 35653390 - 35653435
Alignment:
| Q |
213 |
gtgccttgatcgattcctccaacaatctttccatttcttctctctc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35653390 |
gtgccttgatcgattcctccaacaatctttccatttcttctgtctc |
35653435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 78
Target Start/End: Original strand, 35676866 - 35676906
Alignment:
| Q |
38 |
ggtgccctatgaggtattccctttcttcttgaatttggctt |
78 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
35676866 |
ggtgccctatgagctattccctttctttttgaatttggctt |
35676906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 78
Target Start/End: Original strand, 35682901 - 35682941
Alignment:
| Q |
38 |
ggtgccctatgaggtattccctttcttcttgaatttggctt |
78 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
35682901 |
ggtgccctatgagctattccctttctttttgaatttggctt |
35682941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 258
Target Start/End: Complemental strand, 35099194 - 35099149
Alignment:
| Q |
213 |
gtgccttgatcgattcctccaacaatctttccatttcttctctctc |
258 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
35099194 |
gtgccttgatcgattcttccagtaatctttccatttcttctgtctc |
35099149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 74
Target Start/End: Original strand, 35668017 - 35668053
Alignment:
| Q |
38 |
ggtgccctatgaggtattccctttcttcttgaatttg |
74 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35668017 |
ggtgcccgttgaggtattccctttcttcttgaatttg |
35668053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University