View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10868_low_18 (Length: 260)
Name: NF10868_low_18
Description: NF10868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10868_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 33126961 - 33126727
Alignment:
| Q |
18 |
atgaacgtgtttggcctgtgagtttatcaaacacttatgttttttgttgtttattacgtcatttataatattgacatgatgttatgaaattggtgatgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126961 |
atgaacgtgtttggcctgtgagtttatcaaacacttatgttttttgttgtttattacgtcatttataatattgacatgatgttatgaaattggtgatgat |
33126862 |
T |
|
| Q |
118 |
gcatggtaatggttttgttgagcaggaaatgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtagga |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33126861 |
gcatggtaatcgttttgttgagcaggaaatgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtagga |
33126762 |
T |
|
| Q |
218 |
ggggtaggaggtggaggaatttttatccctttgct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
33126761 |
ggggtaggaggtggaggaatttttatccctatgct |
33126727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 134 - 253
Target Start/End: Original strand, 7568570 - 7568689
Alignment:
| Q |
134 |
gttgagcaggaaatgaagtttggttggagaattgtcgtagggtctattgtcggattttttggagcagcattgggaagtgtaggaggggtaggaggtggag |
233 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||| | || || || ||| | |||||||| |||||||| ||||||||||| ||||| ||||||||||| | |
|
|
| T |
7568570 |
gttgagcaggaaatgaaatttgattggaaaattatagttggatcaattattggatttttgggagcagctttgggaagtgttggaggtgtaggaggtggtg |
7568669 |
T |
|
| Q |
234 |
gaatttttatccctttgctt |
253 |
Q |
| |
|
|||||||| ||||| ||||| |
|
|
| T |
7568670 |
gaatttttgtccctatgctt |
7568689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University