View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10868_low_21 (Length: 250)
Name: NF10868_low_21
Description: NF10868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10868_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 233
Target Start/End: Original strand, 30309232 - 30309463
Alignment:
| Q |
2 |
gtcgagtgagatgaaaggtgttgttcaggtaatgtgacgaggaggaaattgacctttcttgagaaaagatagagagtattcagcagcatcaattaagtca |
101 |
Q |
| |
|
|||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30309232 |
gtcgagggaaatggaaggtgttgttcaggtaatgtgacgaggaggaaattgacctttcttgagaaaagaaagagagtattcagcagcatcaattaagtca |
30309331 |
T |
 |
| Q |
102 |
gcaatgttatgcaaagacctttcatcagaaccaacccaaaacattgcacgtacctctgctttcttcgctaatcttgcagcgaatgtcagtggcaacgaag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30309332 |
gcaatgttatgcaaagacctttcatcagaaccaacccaaaacattgcacgtacctctgctttcttcgctaatcttgcagcgaatgtcagtggcaacgaag |
30309431 |
T |
 |
| Q |
202 |
gagaattgaggcttcgcagtatgtgacgatat |
233 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |
|
|
| T |
30309432 |
gagaattgaggcttcgaagtatgtgacgatat |
30309463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University