View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10868_low_27 (Length: 237)
Name: NF10868_low_27
Description: NF10868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10868_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 74 - 201
Target Start/End: Complemental strand, 370448 - 370332
Alignment:
| Q |
74 |
ttaaactgattccagaaatcattttcaaggaagaatgtcgtcagtaaaacaagatcacctcagtgattcttccaaccctatcattagattgctattacta |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
370448 |
ttaaactgattccagaaatcattttcaaggaagaatgtcgtcagtaaaacaagatcacctcagtgattc-----------tcattagattgctattacta |
370360 |
T |
|
| Q |
174 |
tacaaatctcaaagcttttacataattc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
370359 |
tacaaatctcaaagcttttacataattc |
370332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University