View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10868_low_9 (Length: 343)
Name: NF10868_low_9
Description: NF10868
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10868_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 24 - 327
Target Start/End: Complemental strand, 44649428 - 44649120
Alignment:
| Q |
24 |
agagacattggaaatgggtgatatcactgatatgatatatattcacgtgacacatatagcagca-----tgcatggtaagtcccaaggaggaattgtttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44649428 |
agagacattggaaatgggtgatatcactgatatgatatatattcacgtgacacatatagcagcaatgcatgcatggtaagtcccaaggaggaattgtttc |
44649329 |
T |
|
| Q |
119 |
atgttttctcttatggtgatttaagacattggttggttggtttggttttgacagtgaaaacacaagcagcagtttcacatgcatgccatgccacctctgc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44649328 |
atgttttctcttatggtgatttaagacattggttggttggtttggttttgacagtgaaaacacaagcagcagtttcacatgcatgccatgccacctctgc |
44649229 |
T |
|
| Q |
219 |
ttaatctcatcgatatttgctcaaaagaccctaattgctcacagccccctccaaaatccagaaattaagctacgatcactattttttgggacttaggaag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44649228 |
ttaatctcatcgatatttgctcaaaagaccctaattgctcacagccccctccaaaatccagaaattaagctacgatcactattttttgggacttaggaag |
44649129 |
T |
|
| Q |
319 |
ggatccttg |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
44649128 |
ggatccttg |
44649120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University