View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1086_low_14 (Length: 314)
Name: NF1086_low_14
Description: NF1086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1086_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 52 - 246
Target Start/End: Complemental strand, 42210958 - 42210766
Alignment:
| Q |
52 |
agtattaactaaaaaagttaagagtgtgtgatcctcacttcacatgagatcttatttttctttattggattaagactcaaatatggagaactcaaaaaat |
151 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210958 |
agtattaactaaaaa-gttaagagtgtgtgatcctcacttcacatgagatcttatttttctttattggattaagactcaaatatggagaactcaaaaaat |
42210860 |
T |
|
| Q |
152 |
gggagaaaactttgggnnnnnnntcaaattatttatttctctttataatacttataagataacaaaaatattgtttatagttattttcatctcac |
246 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42210859 |
gggagaaaactttggg-aaaaaatcaaattatttatttctctttataatacttctaagataacaaaaatattgtttatagttattttcatctcac |
42210766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University