View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1086_low_21 (Length: 251)
Name: NF1086_low_21
Description: NF1086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1086_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 41028291 - 41028150
Alignment:
| Q |
1 |
tcctcagtttcaaaacatctcattcaatcgcagagaataagttattcgcaattgcattgcagattacttagcaaaaatggaaaaattgcattgtttagac |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41028291 |
tcctcggtttcaaaacatctcattcaatcgcagagaataagttattcgcaattgcactgcagattacttagcaaaaatggaaaaattgcattgtttagac |
41028192 |
T |
|
| Q |
101 |
attgcaacagatgcagagtttcaaatcaaaactacaacctaa |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41028191 |
attgcaacagatgcagagtttcaaatcaaaactaaaacctaa |
41028150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 41028151 - 41028110
Alignment:
| Q |
171 |
aatactaaagtttggtttcagtgaagatttaatattgtgaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41028151 |
aatactaaagtttggtttcagtgaagattcaatattgtgaat |
41028110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University