View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10870_low_7 (Length: 256)

Name: NF10870_low_7
Description: NF10870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10870_low_7
NF10870_low_7
[»] chr7 (2 HSPs)
chr7 (136-238)||(27223742-27223844)
chr7 (1-65)||(27223525-27223589)


Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 136 - 238
Target Start/End: Original strand, 27223742 - 27223844
Alignment:
136 cagagcttataatataagggtttgagcacctaacaagtgttagaggagagattcaaaaagaagtaaatagatgatcaatgaatttcaccagcaaacttca 235  Q
    ||||||||| | ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||| |    
27223742 cagagcttaaactatgagggtttgagcacctaacaagtgttagaggaaagattcagaaagaagtaaatagatgatcaaagaatttcaccagcaaacttta 27223841  T
236 tca 238  Q
    |||    
27223842 tca 27223844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 27223525 - 27223589
Alignment:
1 tattggaaaatctcactgcttatgagactagactagtctaattaaggtgaaccataataacttgt 65  Q
    |||||||||||| || || ||||| ||||||||||||||| ||| ||||||||||||||||||||    
27223525 tattggaaaatcccagtgtttatgggactagactagtctagttagggtgaaccataataacttgt 27223589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University