View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10870_low_7 (Length: 256)
Name: NF10870_low_7
Description: NF10870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10870_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 136 - 238
Target Start/End: Original strand, 27223742 - 27223844
Alignment:
| Q |
136 |
cagagcttataatataagggtttgagcacctaacaagtgttagaggagagattcaaaaagaagtaaatagatgatcaatgaatttcaccagcaaacttca |
235 |
Q |
| |
|
||||||||| | ||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
27223742 |
cagagcttaaactatgagggtttgagcacctaacaagtgttagaggaaagattcagaaagaagtaaatagatgatcaaagaatttcaccagcaaacttta |
27223841 |
T |
|
| Q |
236 |
tca |
238 |
Q |
| |
|
||| |
|
|
| T |
27223842 |
tca |
27223844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 27223525 - 27223589
Alignment:
| Q |
1 |
tattggaaaatctcactgcttatgagactagactagtctaattaaggtgaaccataataacttgt |
65 |
Q |
| |
|
|||||||||||| || || ||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
27223525 |
tattggaaaatcccagtgtttatgggactagactagtctagttagggtgaaccataataacttgt |
27223589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University