View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10870_low_8 (Length: 251)
Name: NF10870_low_8
Description: NF10870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10870_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 34563836 - 34564063
Alignment:
| Q |
1 |
tatgtgtacgtatgaatcactaaattgaagtgcggttgagtgtatctgatctgaatttagctgaaatcatcatatgttcaattcgtttgccaatgccagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563836 |
tatgtgtacgtatgaatcactaaattgaagtgcggttgagtgtatctgatctgaatttagctgaaatcatcatatgttcaattcgtttgccaatgccagc |
34563935 |
T |
 |
| Q |
101 |
ctgacgagtaaaacggctgcaaattgcaaacaaagaaggatcaaccaatgataatctcaagttgatgtgtcatatccactttacagcccccaccaaatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34563936 |
ctgacgagtaaaacggctgcaaattgcaaacaaagaaggatcaaccaatgataatctcaagttgatgtgtcatatccactttacagcccccaccaaatta |
34564035 |
T |
 |
| Q |
201 |
cgatagcctagtagtgagtcagtaataa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
34564036 |
cgatagcctagtagtgagtcagtaataa |
34564063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University