View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10870_low_9 (Length: 250)
Name: NF10870_low_9
Description: NF10870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10870_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 38 - 206
Target Start/End: Original strand, 35373292 - 35373457
Alignment:
| Q |
38 |
ccatttatgctatttaaatttaagatgttttgaaattactactaaaagtgaatggttactttcattttatatctcaatttatcgatattacttgagcgat |
137 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
35373292 |
ccatgtatgctatttaaatttaagatgttttgaaattactactaaaagtgaatggttactttcattttatatctcgatttatcgatattacttgatcgat |
35373391 |
T |
|
| Q |
138 |
taatttttgtcaataacttttcgacatttctatataaggcaataactagcaattttagtttgtgttcaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35373392 |
taatttttgtcaataacttttcgacatttctatataaggc---aactagcaattttagtttgtgttcaa |
35373457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University