View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10871_high_1 (Length: 341)
Name: NF10871_high_1
Description: NF10871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10871_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 9 - 325
Target Start/End: Original strand, 53209264 - 53209581
Alignment:
| Q |
9 |
agcaaaggaaagaaaagtcacatccttaaacaaacatgggaatgcatgaattagcttggtttttgtctatcacgagttacgttcggcctagtcattgtaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53209264 |
agcaaaggaaagaaaagtcacatccttaaacaaacatgggaatgcatgaattagcttggtttttgtctatcacgagttacgctcggcctagtcattgtaa |
53209363 |
T |
|
| Q |
109 |
gatacttgatagtcatagattacaggttttgccaaagttatggtgcgtcactaagattatgcagaagctgcaccttataggttttgtaaaattacggtgg |
208 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53209364 |
ggtacttgatagtcatagattacaggttttgccaaagttatggtgcgtcactaagattatgctgaagctgcatcttataggttttgtaaaattacggtgg |
53209463 |
T |
|
| Q |
209 |
tttactg-tgattctgatcaattcgtcgtgatatcaaacatacaataagttaaacaatcttataattttatagagtaaaataatttttactcaatttaga |
307 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53209464 |
tttactgaggattctgatcaattcgtcgtgatatcaaacatacaataagttcaacaatcttataattttatagagtaaaataatttttactcaatttaga |
53209563 |
T |
|
| Q |
308 |
tttttctaaatatattac |
325 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
53209564 |
tttttctaaacatattac |
53209581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 225
Target Start/End: Original strand, 20605266 - 20605320
Alignment:
| Q |
171 |
agaagctgcaccttataggttttgtaaaattacggtggtttactgtgattctgat |
225 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||| ||| |||||||||| |
|
|
| T |
20605266 |
agaagctacaccttatagcatttataaaattacggtggttcactatgattctgat |
20605320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University