View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10871_high_5 (Length: 225)
Name: NF10871_high_5
Description: NF10871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10871_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 207
Target Start/End: Original strand, 44636064 - 44636255
Alignment:
| Q |
16 |
agacaaaaagttgcaagttttgcataaaaatatggggaaaaccccgtctatttgcagcagtaatctgattatttgtttgctccaatccatatatacggta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44636064 |
agacaaaaagttgcaagttttgcataaaaatatggggaaaaccccgtctatttgtagcagtaatctgattatttgtttgctccaatccatatatacggta |
44636163 |
T |
 |
| Q |
116 |
ataagatggagtatcatttcatgtgcatagcaaagtataactataacgtgatggatctcatgcaaaatagttaacatcaaataataatactt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44636164 |
ataagatggagtatcatttcatgtgcatagcaaagtataactataacgtgatggatctcatgcaaaatagttaacatcaaataataatactt |
44636255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University