View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10871_low_13 (Length: 209)
Name: NF10871_low_13
Description: NF10871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10871_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 54224758 - 54224576
Alignment:
| Q |
15 |
gaacatggtaataggcaatatgaaattatctttagtgttgttttggttacattgatgttcaaacatgtgtaaggtatgagttaaggtcacggtctaagct |
114 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54224758 |
gaacatggcaataggcaatatgaaattatctttagtgttgttttggttacattgatgttcaaacatgtgaaaggtatgagttaaggtcacggtctaagct |
54224659 |
T |
|
| Q |
115 |
ttcatacctcaactgttaagggtcattttcaatctgatggttttgcagggtcacgcccctattctttttctttatttgatgtc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54224658 |
ttcatacctcaactgttaagggtcattttcaatctgatggttttgcagggtcacgcccctattctttttctttatttggtgtc |
54224576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University