View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10871_low_4 (Length: 309)
Name: NF10871_low_4
Description: NF10871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10871_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 14 - 295
Target Start/End: Complemental strand, 49623790 - 49623505
Alignment:
| Q |
14 |
agcagagatctcgtgtcaagtcgatccgccacttgtgcagcgttcttcttcattgtctcatggtaactttccaattatcatatttagtaaagagtagatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49623790 |
agcagagatctcgtgtcaagtcgatccgccacttgtgcagcgttcttcttcattgtctcatggtaactttccaattatcatatttagtaaagagtagatt |
49623691 |
T |
|
| Q |
114 |
gttcatggttaattaaaggggaaattaaaaatatggtattgtgatggttgacctagaccaaatata----tataattgagatgaactttttggcttttag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
49623690 |
gttcatggttaattaaaggggaaattaaaaatatggtattgtgatggttgacctagaccaaatatatatatataattgagatgaattttttggcttttag |
49623591 |
T |
|
| Q |
210 |
tttgagttcatatgttattgtgttatcaggattgttttcttggcagcagaagcgtgcttgttggcagcatctgttatgaatgcaat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
49623590 |
tttgagttcatatgttattgtgttatcaggattgttttcttggcagcagaagcatgcttgctggcagcatctgttatgaatgcaat |
49623505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 56 - 150
Target Start/End: Complemental strand, 14335678 - 14335588
Alignment:
| Q |
56 |
ttcttcttcattgtctcatggtaactttccaattatcatatttagtaaagagtagattgttcatggttaattaaaggggaaattaaaaatatggt |
150 |
Q |
| |
|
||||||| | || ||||||||||||||||||||||||| || ||||||||||||||| |||| ||||||||| | ||||||||||||| |||| |
|
|
| T |
14335678 |
ttcttctacgttctctcatggtaactttccaattatca-at---gtaaagagtagattgctcatagttaattaaggaggaaattaaaaatgtggt |
14335588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University