View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10871_low_8 (Length: 240)
Name: NF10871_low_8
Description: NF10871
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10871_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 3810758 - 3810534
Alignment:
| Q |
1 |
taggctgttgtgtgccagggtgatgctcttatcggaacgcctaaaacatatttttgagaggctcggccttgccaaatgcgtcattgctattattcctatg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3810758 |
taggctgctgtgtgccagggtgatgctcttatcggaacgcctaaaacatatttttgagaggctcggccttgccaaacgcgtcattgctattattcctatg |
3810659 |
T |
|
| Q |
101 |
tatattgcagattggataaatatcacagccatctccgaagcatacctgcaccaattataagtcaaattttacatcagctttcagtttcataatgtgagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810658 |
tatattgcagattggataaatatcacagccatctccgaagcatacctgcaccaattataagtcaaattttacatcagctttcagtttcataatgtgagaa |
3810559 |
T |
|
| Q |
201 |
aattatctggcgcgacagaaataag |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3810558 |
aattatctggcgcgacagaaataag |
3810534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 47 - 132
Target Start/End: Original strand, 41672840 - 41672925
Alignment:
| Q |
47 |
catatttttgagaggctcggccttgccaaatgcgtcattgctattattcctatgtatattgcagattggataaatatcacagccat |
132 |
Q |
| |
|
|||| |||||||||||| |||||||||||| | |||| |||||||||||| | |||||||| ||||| |||| |||||||||||| |
|
|
| T |
41672840 |
cataattttgagaggcttggccttgccaaacgagtcagtgctattattccaagatatattgctgattgaataagtatcacagccat |
41672925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University