View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10872_low_2 (Length: 325)
Name: NF10872_low_2
Description: NF10872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10872_low_2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 8 - 325
Target Start/End: Original strand, 9889143 - 9889460
Alignment:
| Q |
8 |
tagcagagaatatggtagatgtggttgtgattgcaatcatgttgtggtagcaaagatctaaaaaccgtgatgttgttggaacatttgtaataggggacca |
107 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9889143 |
tagcagagaatatggcagatgcggttgtgatttcaatcatgttgtggtagcaaagatataaaaaccgtgatgttgttggaacatttgtaataggggacca |
9889242 |
T |
|
| Q |
108 |
nnnnnnnataatttgattgcggttacgttgcgattcatggtttaaatagtgatcacgatagcaattgttattgtgtcgcaatccttgatatggcgaagaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9889243 |
tttttttataatttgattgcggttacgttgcgattcatggtttaaatagtgatcacgatagcaattgtgattgtgtcgcaatccttgatatggcgaagaa |
9889342 |
T |
|
| Q |
208 |
tgcacggtcaaatgtggccgatacggcctcaataacgatcatgttttttcgacaacatctaaaatctttatgatgcagtccagatcacaattgcagacct |
307 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9889343 |
tgcacggtcaaatgtggtcgatacggcctcaataacgatcatgttttttcgacaacatctaaaatctttatgatgcagtccagatcacaattgcagacct |
9889442 |
T |
|
| Q |
308 |
ttacttaaaacctttgct |
325 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9889443 |
ttacttaaaacctttgct |
9889460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University