View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10873_high_3 (Length: 323)
Name: NF10873_high_3
Description: NF10873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10873_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 48787710 - 48787535
Alignment:
| Q |
19 |
tttctagagtgctgcttgtcgagttgctctcatccttttaatgataatttcatttttcctagattggtgtggtccatgcttatataacagcgtgtaaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48787710 |
tttctagagtgctgcttgtcgagttgctctcatccttttaatgataatttcatttttcctagattggtgtggtccatgcttatataacagtgtgtaaaat |
48787611 |
T |
 |
| Q |
119 |
gaaaattcatatctaacaacacataattnnnnnnncaatatgatgtggacatcaatttataagtactgaaatacat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48787610 |
gaaaattcatatctaacaacacataattaaaaaaacaatatgatgtggacatcaatttataagtactgaaatacat |
48787535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University