View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10873_high_7 (Length: 225)

Name: NF10873_high_7
Description: NF10873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10873_high_7
NF10873_high_7
[»] chr2 (1 HSPs)
chr2 (19-206)||(45075949-45076136)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 45076136 - 45075949
Alignment:
19 tatagtctttaactagtgccccaagtgtcactggttaacatttccctaaaatatttgaatgagaaagagtgattgattgagagagagatgaacaatgtca 118  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45076136 tatagtctttaactagtgccccaagtgtcactagttaacatttccctaaaatatttgaatgagaaagagtgattgattgagagagagatgaacaatgtca 45076037  T
119 ctaatatcatcaaaagctaatttcatccaagtgaaatcccaaaaaagtagatggcacaaaagaggatagtgtcgcgaggtttatggct 206  Q
    |||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
45076036 ctaatatcatgaaaaactaatttcatccaagtgaaatcccaaaaaagtagatgggacaaaagaggatagtgtcgcgaggtttatggct 45075949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University