View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10873_low_11 (Length: 228)
Name: NF10873_low_11
Description: NF10873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10873_low_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 35829231 - 35829459
Alignment:
| Q |
1 |
aaaagacacaatcgaaagaggtactcacatttaatttccggtacactttggatatgattactccggcgcgaatggaacttgtggggnnnnnnnnn-ttat |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
35829231 |
aaaagacacaatcgaaagaggtactgacatttaatttccggtacattttggatatgattactccggcgcgaatggaacttatgggaaaaataataattat |
35829330 |
T |
 |
| Q |
100 |
tttacttgtactttgtttctatgaccaatatacacatgatgaaaaatttgttaccataacaaggtgcatcaaacacacctcaaggacacctccatcagac |
199 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35829331 |
tttacttgtactttgtatctatgaccaatatacacatgatgaaaaatttgttaccattacaaggtgcatcaaacacacctcaaggacacctccatcagac |
35829430 |
T |
 |
| Q |
200 |
tatcaggtttgcctataaaaggtggtgac |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35829431 |
tatcaggtttgcctataaaaggtggtgac |
35829459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University