View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10873_low_13 (Length: 210)
Name: NF10873_low_13
Description: NF10873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10873_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 24 - 193
Target Start/End: Original strand, 50712369 - 50712538
Alignment:
| Q |
24 |
agaagccaccaggaacaatttcatatcgaccatacactatcctcaatatttcttctggagtccttgaatatgaaactgaatttttgtcaccagcaagtac |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50712369 |
agaagccaccaggaacaatttcatatcgaccatacactatcctcaatatttcttctggagtccttgaatatgaaagtgaatttttgtcaccagcaagtac |
50712468 |
T |
|
| Q |
124 |
atttcctgaaactttaccttcagcaccctgtgatatagggacctctagaccctcatcttttacgcctttg |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50712469 |
atttcctgaaactttaccttcagcaccttgtgatatagggacctctagaccctcatcttttacgcctttg |
50712538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 132
Target Start/End: Complemental strand, 12772025 - 12771958
Alignment:
| Q |
65 |
ctcaatatttcttctggagtccttgaatatgaaactgaatttttgtcaccagcaagtacatttcctga |
132 |
Q |
| |
|
||||||||||| | |||||| ||||||||||| | ||||||||| ||||||||||| | ||||||||| |
|
|
| T |
12772025 |
ctcaatatttcatttggagttcttgaatatgatagtgaatttttatcaccagcaaggatatttcctga |
12771958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 96
Target Start/End: Complemental strand, 12762618 - 12762584
Alignment:
| Q |
62 |
atcctcaatatttcttctggagtccttgaatatga |
96 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
12762618 |
atcctcaatatttcttgtggagtccttgaatatga |
12762584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University