View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10873_low_5 (Length: 279)
Name: NF10873_low_5
Description: NF10873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10873_low_5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 279
Target Start/End: Original strand, 39299606 - 39299869
Alignment:
| Q |
1 |
cctcttgttcctaaatcctctgtctttcttcccctctcgcccacaactttccctgttcccattcctctgttcatttctttcacatgtggtgttccagaaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299606 |
cctcttgttcctaaatcctctgtttttcttcctttctctgccacaacttgtcctgttcccattcctctgttcatttctttcacatgtggtgttccagaaa |
39299705 |
T |
|
| Q |
101 |
ccactttggttcggctatcaagtttttctctatcatctgttaaaccttttgattccatttgaaactttcccacatcacgaaaaccaccaaaatcttcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39299706 |
ccactttggttcggctatcaagtttttctctatcatcggttaaaccttttgattccatttgaaactttcccacatcacgaacaccaccaaaatcttct-- |
39299803 |
T |
|
| Q |
201 |
tccccctactctgtttccttctacatttgcactatcacgaacatgtgcacgatcaaggtaactttgattctcgttacga |
279 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299804 |
-------------tttcctgctacatttgcactatcacgaacatgtgcacgatcaaggtaactttgattctcgttacga |
39299869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University