View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10874_low_2 (Length: 284)
Name: NF10874_low_2
Description: NF10874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10874_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 109 - 274
Target Start/End: Complemental strand, 18878187 - 18878021
Alignment:
| Q |
109 |
gtcaaaccaagtt-gtatgttcatcgttggaaatggaccaaccaccgtggaaggaagaagaagcggcggttggcggtggtgataggggaccaccacagcg |
207 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18878187 |
gtcaaaccaagtttgtatgttcatcgttggaaatggaccaaccaccgtggaaggaagaagaagcggcggttggcggtggtgatgggggaccaccacagcg |
18878088 |
T |
|
| Q |
208 |
gcccaccttaactctgccgccacgtacggatgcacttttcagcggtggttttagccctggtcctatg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18878087 |
gcccaccttaactctgccgccacgtacggatgtacttttcagcggtggttttagccctggtcctatg |
18878021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 79
Target Start/End: Complemental strand, 18878279 - 18878217
Alignment:
| Q |
17 |
agatagattatagtacaacattgtttctctctatttttggaccaaccaacaatcacaaacttc |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18878279 |
agatagattatagtacaacattgtttctctctatttttggaccaaccaacaatcacaaacttc |
18878217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University