View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10875_high_1 (Length: 500)
Name: NF10875_high_1
Description: NF10875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10875_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 4e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 2 - 180
Target Start/End: Original strand, 21947475 - 21947655
Alignment:
| Q |
2 |
cacttgtttcaaattggtatgtcgtccaaaaactc--aaagtaaaaactctggcgctaattaagtcagaattccaacattaacgcctgcattaatagcaa |
99 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21947475 |
cacttctttcaaattggtatgtcgaacaaaaactctcaaagtaaaaactctgctgctaattaagtcagaattccaacattaacgcctgcactaatagcaa |
21947574 |
T |
|
| Q |
100 |
aaccataatcaattttgaagtagaagcgtaatggaccaacaggaaaataatttctaggaaatcaatcaaatgcataagtag |
180 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21947575 |
aaccataataaattttcaagtagaagcgtaatggaccagcagaaaaataatttctaggaaatcaatcaaatgcataagtag |
21947655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University