View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10875_low_1 (Length: 500)

Name: NF10875_low_1
Description: NF10875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10875_low_1
NF10875_low_1
[»] chr2 (1 HSPs)
chr2 (2-180)||(21947475-21947655)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 4e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 2 - 180
Target Start/End: Original strand, 21947475 - 21947655
Alignment:
2 cacttgtttcaaattggtatgtcgtccaaaaactc--aaagtaaaaactctggcgctaattaagtcagaattccaacattaacgcctgcattaatagcaa 99  Q
    ||||| ||||||||||||||||||  |||||||||  |||||||||||||||  |||||||||||||||||||||||||||||||||||| |||||||||    
21947475 cacttctttcaaattggtatgtcgaacaaaaactctcaaagtaaaaactctgctgctaattaagtcagaattccaacattaacgcctgcactaatagcaa 21947574  T
100 aaccataatcaattttgaagtagaagcgtaatggaccaacaggaaaataatttctaggaaatcaatcaaatgcataagtag 180  Q
    ||||||||| |||||| ||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||    
21947575 aaccataataaattttcaagtagaagcgtaatggaccagcagaaaaataatttctaggaaatcaatcaaatgcataagtag 21947655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University