View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10875_low_3 (Length: 250)
Name: NF10875_low_3
Description: NF10875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10875_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 35890043 - 35890291
Alignment:
| Q |
1 |
tgcggcagctttcggcttcacagc---agctttcgcctttggcttagttgcagccttagcggctggcttggtaacagccttagccttcttagcaggagca |
97 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35890043 |
tgcggcagctttcggcttcacagcagcagctttcgcctttggcttagttgcagccttagcggctggcttggtaacagccttagccttcttagcaggagca |
35890142 |
T |
 |
| Q |
98 |
atagcggccttcaccggagcagttttggccacagctggggcgattttgaaggagtttttcaccttgacgagctttccagaagccacagatttcttcagat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
35890143 |
atagcggccttcaccggagcagttttggccacagctggggcgattttgaaggagtttttcaccttcacaagctttccagaagccacagatttcttcagat |
35890242 |
T |
 |
| Q |
198 |
gaagaagaatgagtttgcggaatgttggagataaatccctttgcttctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
35890243 |
gaagaagaatgagtttgcggaatgttggagataaatccttatgcttctc |
35890291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University