View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10875_low_6 (Length: 238)
Name: NF10875_low_6
Description: NF10875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10875_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 40728433 - 40728290
Alignment:
| Q |
1 |
ttgataaaggggaaaattggcttgtcaacacttatatttttgaagcttaatgtttcattttttgggatacaatttttgtttacaaagttggttgtgaaag |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40728433 |
ttgataaaggggaaaattggtttgtcaacacttatatttttgaagcttaatgtttcattttttgggatacaatttttgtttacaaagttggttgtgaaag |
40728334 |
T |
|
| Q |
101 |
cttgggggttgactttggtggacagaacagcatatggaatacta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40728333 |
cttgggggttgactttggtggacagaacagcatatggaatacta |
40728290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 95
Target Start/End: Complemental strand, 40724310 - 40724280
Alignment:
| Q |
65 |
ggatacaatttttgtttacaaagttggttgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40724310 |
ggatacaatttttgtttacaaagttggttgt |
40724280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University