View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10876_high_3 (Length: 240)
Name: NF10876_high_3
Description: NF10876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10876_high_3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 5418861 - 5419083
Alignment:
| Q |
18 |
cattgctggcactggtatgttataagctcaattgggagttatattactctattaatagttattactttattatactctactcattttaaattttggatgg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5418861 |
cattgctggcactggtatgttataagctcaattgggagt-atattactctattaatagttattcctttattatactctactcattttaaatttttgatgg |
5418959 |
T |
|
| Q |
118 |
ttggtttgagggtgagatgttttttagggaaaataatcatagtttaagannnnnnncctt-nnnnnnntattaatagtttaagatttttgtacaccgatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
5418960 |
ttggtttgagggtgagatgttttttagggaaaataatcatagtttaagatttttttccttaaaaaaactattcatagtttaagatttttgtacaccgatt |
5419059 |
T |
|
| Q |
217 |
aaaagattatttaatttgattgat |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5419060 |
aaaagattatttaatttgattgat |
5419083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University