View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10876_high_9 (Length: 212)
Name: NF10876_high_9
Description: NF10876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10876_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 36575928 - 36575747
Alignment:
| Q |
18 |
gtatcttcatgtggttctttaatttctacttttgtcctgtttattttacttgttcaagtcgttaatccatatgtttcgtgctcgtagcatattttgtggg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36575928 |
gtatcttcatgtggttctttaatttctacttttgtcctgtttattttacttgttcaagtcgttaatccatatgtttcgtgctcgtagcatattttgtggg |
36575829 |
T |
|
| Q |
118 |
cggatagagcttttgcccctggtaatcaattttttttccaaaaatagagannnnnnnnnaaatccctagtctgtttctttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36575828 |
cggatagagcttttgcccctggtaatcaattt-ttttccaaaaatagagatttttttttaaatccctagtctgtttctttctt |
36575747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University