View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10876_low_11 (Length: 239)
Name: NF10876_low_11
Description: NF10876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10876_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 1640735 - 1640959
Alignment:
| Q |
1 |
gatgctaaactagttcaggtgagttatacggtaattggaacgtagattacggtttttgctaattaagtctcaatcaaaacgccatagtaagttaccaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1640735 |
gatgctaaactagttcaggtgagttatacggtaattggaacgtagattacggtttttgctaattaagtctcaatcaaaacgccatagtaagttaccaacc |
1640834 |
T |
 |
| Q |
101 |
agcttctgcaggtaaactcaaatgcataaataccaatcttctgattgagggagaaatcgaaccagtcttatctacatcaattctttaatattttgca--a |
198 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
1640835 |
agcttctgcgggtaaactcaaatgcataaataccaatcttctgattgagggagaaatcgaaccagtcttatctacatcaattctttaa-attttgcaaga |
1640933 |
T |
 |
| Q |
199 |
ccatcgcaatgtgatttacactaact |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1640934 |
ccatcgcaatgtgatttacactaact |
1640959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University