View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10878_low_10 (Length: 288)
Name: NF10878_low_10
Description: NF10878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10878_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 16 - 141
Target Start/End: Complemental strand, 40197923 - 40197798
Alignment:
| Q |
16 |
aaattaatcatcaatgaataacgagatgaagaatcagaaattgtgataagaacctgttggcggaacataggagtgtcatctagatttgagaaatgcannn |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40197923 |
aaattaatcatcaatgaataacgagatgaagaatcagaaattgtgataagaacctgttggcggaacataggagtgtcatctagatttgagaaatgcattt |
40197824 |
T |
|
| Q |
116 |
nnnnaatataatcaaaattcttcttc |
141 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40197823 |
ttttaatataatcaaaattcttcttc |
40197798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 189 - 245
Target Start/End: Complemental strand, 40197738 - 40197682
Alignment:
| Q |
189 |
cggttaacgatggttgcttgcgatatttaatgtccatcgctacctctcatcaatcaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40197738 |
cggttaacgatggttgcttgcgatatttaatgtccatcgctacctctcatcaatcaa |
40197682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University