View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10878_low_12 (Length: 259)
Name: NF10878_low_12
Description: NF10878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10878_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 23 - 244
Target Start/End: Complemental strand, 20113445 - 20113224
Alignment:
| Q |
23 |
gaggagggagttgaatgatttgagagtaggagtgcagcgaaaggaagggatagagaggaaggtttgaacggcacgtgaaggaagacgggcacgtgcatag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20113445 |
gaggagggagttgaatgatttgagagtaggggtgcagcgaaaggaagggatagagaggaaggtttgaacggcacgtgaaggaagacgggcacgtgcatag |
20113346 |
T |
 |
| Q |
123 |
aaggagatgacgtggcagaggaggggttcagggacgcggtggcgagtgtcgttgtggagttgttgaaggataagttccatttgagggatcattttggcgc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20113345 |
aaggagatgacgtggcagaggaggggttcagggacgcggtggcgagtgtcgttgtggagttgttgaaggataagttccatttgagggatcattttggcgc |
20113246 |
T |
 |
| Q |
223 |
ggccgagtttggtgatgatgag |
244 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
20113245 |
ggccgagtttggtgatgatgag |
20113224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University