View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10878_low_16 (Length: 251)
Name: NF10878_low_16
Description: NF10878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10878_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 16 - 82
Target Start/End: Original strand, 27184578 - 27184644
Alignment:
| Q |
16 |
aggggattcaccattgacaaccaaatctctcaaactcaagttgagtgatttatggccaagcctaaaa |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||| |
|
|
| T |
27184578 |
aggggattcaccattgacaaccaaatctctcaaactcaagttgaatgatttcttgccaagcctaaaa |
27184644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 188
Target Start/End: Complemental strand, 38173026 - 38172981
Alignment:
| Q |
143 |
gatatgtgcaagattttggctcttggagcagttaatctgagacttg |
188 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
38173026 |
gatatgcgcaagattttggctcttggagcagttaatttgaaacttg |
38172981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University