View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10878_low_20 (Length: 209)
Name: NF10878_low_20
Description: NF10878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10878_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 37492849 - 37493031
Alignment:
| Q |
11 |
aagcagagacaagaaataaaactatatcaaaaaagcatatgcatgagttgtttcagaatctggaaacttggttgcattagattaaagcttttggttggca |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492849 |
aagcagggacaagaaataaaactatatcaaaaaagcatatgcatgagttgtttcagaatctggaaacttggttgcattagattaaagcttttggttggca |
37492948 |
T |
|
| Q |
111 |
ccccaaaaatgctgaatttgattggctaacttcaaacaattcgacacttgcctttctgatccctaaatttgtggatttctttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37492949 |
ccccaaaaatgctgaatttgattggctaacttcaaacaattcgacacttgcctttctgatccctaaatttgtggatttctttt |
37493031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University