View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10879_high_12 (Length: 246)
Name: NF10879_high_12
Description: NF10879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10879_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 34857364 - 34857146
Alignment:
| Q |
18 |
agatgaaggtcagaagtatcatatacacagttgtatagatgaaataaatagacatttaaagaatcgcggtctctggatgatgttggacaactttttcctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34857364 |
agatgaaggtcagaagtatcatatacacagttgtatagatgaaataaatagacatttaaagaatcgcggtctctggatgatgttggacaactttttcctc |
34857265 |
T |
 |
| Q |
118 |
tgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatcactaacagttctataatatgaatatcccttgactattaaagttggtaact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34857264 |
tgttgtgcccttcaaaaggagaagggggtggaatatatgcaatagtaatccctaacagttctataatatgaatatcccttgactattaaagtttgtaact |
34857165 |
T |
 |
| Q |
218 |
gttatgcagcctacctatg |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34857164 |
gttatgcagcctacctatg |
34857146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University