View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10879_high_13 (Length: 238)
Name: NF10879_high_13
Description: NF10879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10879_high_13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 40181233 - 40181007
Alignment:
| Q |
16 |
atatgatccaccaaacagcttctatctatcaaaagttgctgctactccatgatgatgatcaagaagaatacaaccaccttcttccttgttatgacgacga |
115 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40181233 |
atatgatccaccaagcagagtctatctatcaaaagttgctgctactccatgatgatgatcaagaagaatacaaccaccttcttccttgttatgacgacga |
40181134 |
T |
 |
| Q |
116 |
tgacaaggtcaccacatctgaaagtttccagagaatactgac----acgtctcagtgacgttcctgttttccgtgactataggtaccaaattaaatcagc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40181133 |
tgacaaggtcaccacatctgaaagtttccagagagtactgacacgtacgtctcagtgacgttcctgttttccgtgactataggtacaaaattaaatcagc |
40181034 |
T |
 |
| Q |
212 |
tatcaaattcatggactttgccactcc |
238 |
Q |
| |
|
||| |||||||||||||||||||||| |
|
|
| T |
40181033 |
tattgaattcatggactttgccactcc |
40181007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University