View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10879_low_10 (Length: 304)
Name: NF10879_low_10
Description: NF10879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10879_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 12138478 - 12138763
Alignment:
| Q |
1 |
gttgaaaacatgtgtgacataaaagtctgaaaatattagatgtattcaagattcaaaatatccttgttagaaaatatgaaagtttctgaagaaacaaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12138478 |
gttgaaaacatgtgtgacataaaagtctgaaaatattagatgtattcaagattcaaaatatccttgttagaaaatatgaaagttgctgaagaaacaaatg |
12138577 |
T |
|
| Q |
101 |
tagtgtatggaaagtcattgtaattgagataatgctttgaaattatacacaacagcagacatggaattcatattttgaattattatttattagtctcatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12138578 |
tagtgtatggaaagtcattgtaattgagataatgctttgaaattatacacaacagcagacatggaattcatattttgaattattatttattagtctcatc |
12138677 |
T |
|
| Q |
201 |
atggaaataaaattgccatttatttctatgtgtctactaaatagcatccatagcattcattattcctataatccataatactagat |
286 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12138678 |
atggaaataaaattgccatttatttctctgtgtctactaaatagcatccgtagcattcattattcctataatccataatactagat |
12138763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University