View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10879_low_12 (Length: 268)
Name: NF10879_low_12
Description: NF10879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10879_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 252
Target Start/End: Complemental strand, 3724103 - 3723863
Alignment:
| Q |
13 |
cagagaccacacgaccaccataaaccgaacatctatgtaccaaagtttcatcaaactccgcagaaccgtccaatacccttgacgggcaggtctgcaaaat |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3724103 |
cagacaccacacgaccaccataaaccgaacatctatgtaccaaagtttcatcaaactccgcagaaccgtccaatacccttgaagggcaggtctgcaaaat |
3724004 |
T |
|
| Q |
113 |
gctatttttccttttccaatgcacatttaacctaacaccgttgaaactcaaaggcagtccctcaatcgaatgaacatgaagatt-aaagcaacaaacaaa |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3724003 |
gctatttttccttttccaatgcacacttaacctaacgccgtcgaaactcaaaggcagtccctcaatcgaatgaacatgaagattaaaagcaacaaacaaa |
3723904 |
T |
|
| Q |
212 |
cttctgtgaaccaatatttgttaaaactttcaagggcttct |
252 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3723903 |
cttctgcgaaccaatatttgttaaaactttcaagggcttct |
3723863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University