View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10879_low_14 (Length: 257)
Name: NF10879_low_14
Description: NF10879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10879_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 5972455 - 5972696
Alignment:
| Q |
19 |
tgttctgcaggggatacttcatcagatgattcaatgatttttt-cccaaaaatgaccattcaacctagcactatctggcgaaagaggaattgtgannnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5972455 |
tgttctgcaggggatacttcatcagatgatccaatgatttttttcccaaaaatgaccattcaacctagcactatccggcgaaagaggaattgtgattttt |
5972554 |
T |
|
| Q |
118 |
nnctcg------------tattttcatcttgatgtctcttcggcttgggggataggcgaaagaaccatgaaatcatgaagaatatttcaaaacttattga |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5972555 |
ttctcggtaaatttctcgtattttcatcttgatgtctcttcggcttgggggataggcgaaagaaccatgaaatcatgaagaatatttcaaaacttattaa |
5972654 |
T |
|
| Q |
206 |
tgaaccaaaattaaaacctttgttggaatattgttgcctatg |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5972655 |
tgaaccaaaattaaaacctttgttggaatattgttgcctatg |
5972696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 107
Target Start/End: Original strand, 5909716 - 5909805
Alignment:
| Q |
19 |
tgttctgcaggggatacttcatcagatgattcaatgatttt-ttcccaaaaatgaccattcaacctagcactatctggcgaaagaggaat |
107 |
Q |
| |
|
|||| |||||||||| ||||||||||||| |||||||||| |||||||||| ||| ||||||||||||||||| |||| ||||||||| |
|
|
| T |
5909716 |
tgttttgcaggggattcttcatcagatgaaccaatgattttattcccaaaaaggacatttcaacctagcactatccggcggaagaggaat |
5909805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 29 - 107
Target Start/End: Original strand, 5939246 - 5939325
Alignment:
| Q |
29 |
gggatacttcatcagatgattcaatgatttt-ttcccaaaaatgaccattcaacctagcactatctggcgaaagaggaat |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| ||||| |||| ||||||||||||||||| || ||||||||||| |
|
|
| T |
5939246 |
gggatacttcatcagatgatacaatgattttattctcaaaatggacctttcaacctagcactatccggggaaagaggaat |
5939325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University