View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10879_low_23 (Length: 240)
Name: NF10879_low_23
Description: NF10879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10879_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 9764602 - 9764824
Alignment:
| Q |
1 |
cggttcttatacaacttgtgcagttgttgtatcagtggctttctgtgggagtgagggttgatgttgagtttctgaaacaattggttcagttattgtttca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9764602 |
cggttctgatacaacttgtgcagttgttgtatcagtggctttctgtgggagtgagggttgatgttgagtttctgaaacaattggttcagttattgtttca |
9764701 |
T |
|
| Q |
101 |
ggggctatttgtgtagtttgggttggtatttgtttagatagttcaccacccaaattctgagaaagtacatctatattggatgatgaactttggtttggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9764702 |
ggggctatttgtgtagtttgggttggtatttgtttagatagttcaccacccaaattctgagaaagtacatctatattggatgatgaactttggtttggta |
9764801 |
T |
|
| Q |
201 |
agatagaggttgatgtaccaaag |
223 |
Q |
| |
|
||||| |||||||| |||||||| |
|
|
| T |
9764802 |
agatataggttgatataccaaag |
9764824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 90 - 174
Target Start/End: Complemental strand, 19641622 - 19641538
Alignment:
| Q |
90 |
ttattgtttcaggggctatttgtgtagtttgggttggtatttgtttagatagttcaccacccaaattctgagaaagtacatctat |
174 |
Q |
| |
|
|||||||||||| ||| |||| ||||||||||||||||||||||||| |||||| ||||||| || || ||||| |||||||| |
|
|
| T |
19641622 |
ttattgtttcagaagctgtttgagtagtttgggttggtatttgtttaggtagttctccacccagatgttgtgaaagaacatctat |
19641538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University