View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1087_high_4 (Length: 251)
Name: NF1087_high_4
Description: NF1087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1087_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 29 - 132
Target Start/End: Complemental strand, 3708658 - 3708555
Alignment:
| Q |
29 |
aaaatgacgaagaatatattgtgttacttgctatatagttggtggcgttcttgatgatcaatacggatgacaccaaaaattatatttaatacatgaaaat |
128 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3708658 |
aaaatgacggagaatatattgtgttacttgctatatagttggtggcgttcttgatgatcaatacggatgacaccaaaaattatatttaatacatgaaaat |
3708559 |
T |
|
| Q |
129 |
cagg |
132 |
Q |
| |
|
|||| |
|
|
| T |
3708558 |
cagg |
3708555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University