View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1087_low_7 (Length: 251)

Name: NF1087_low_7
Description: NF1087
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1087_low_7
NF1087_low_7
[»] chr1 (1 HSPs)
chr1 (29-132)||(3708555-3708658)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 29 - 132
Target Start/End: Complemental strand, 3708658 - 3708555
Alignment:
29 aaaatgacgaagaatatattgtgttacttgctatatagttggtggcgttcttgatgatcaatacggatgacaccaaaaattatatttaatacatgaaaat 128  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3708658 aaaatgacggagaatatattgtgttacttgctatatagttggtggcgttcttgatgatcaatacggatgacaccaaaaattatatttaatacatgaaaat 3708559  T
129 cagg 132  Q
    ||||    
3708558 cagg 3708555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University