View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10880_low_9 (Length: 262)
Name: NF10880_low_9
Description: NF10880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10880_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 38974148 - 38973901
Alignment:
| Q |
16 |
atggacatgtgttccatttctaactcgtgtgtattatgaaaagttggttggaactactcacatgtattttctttataactcnnnnnnngttaatagaaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38974148 |
atggacatgtgttccatttctaactcgtgtgtattatgaaaagttggttggaactactcacatgtattttctttataactctttttttgttaatagaaaa |
38974049 |
T |
|
| Q |
116 |
aagtttagttgatcaggatcatgacagatcttaaaactcatagaattgaacccacaacctt--atattagtgaattcgtgatcaactcagccaatctaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38974048 |
aagtttagttgatcaggatcatgacatatctcaaaactcatagaattgaacccacaaccttacatattagtgaattcgtgatcaactcagccaatttaga |
38973949 |
T |
|
| Q |
214 |
ttggctgttttatagctatctcttgttagcatttctcctatgctactc |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
38973948 |
ttggctgttttatagctatctcttgttagcatttctcttatggtactc |
38973901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University