View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10881_high_9 (Length: 279)
Name: NF10881_high_9
Description: NF10881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10881_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 16 - 269
Target Start/End: Complemental strand, 1139823 - 1139556
Alignment:
| Q |
16 |
attttttcattctagattagtttcttttcacaaattattgtggttctatttatctttttgtagtttaatgttctgttatatattct---tcaattatat- |
111 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | | |||| || |||||| |
|
|
| T |
1139823 |
attttttcattctaaattagtttcttttcacaaattattgtggttctatttatctttttgtagtttaatgatctgtttttttttctctttctgttatatt |
1139724 |
T |
 |
| Q |
112 |
----------atatacgattaacaatttcaaaactggtatgaatcttcattgtcatttgggattctcttttgaattttaagatgattttattcatatcac |
201 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
1139723 |
ttcttcaattatatacgattaacaatttcaaaattgatatgaatcttcattgtcatttgagattttcttttgaattttaagattattttattcatatcac |
1139624 |
T |
 |
| Q |
202 |
aaataattaaacctaaccttgcattgatgcaataatatataactttatcgacaattttaacacctttg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1139623 |
aaataattaaacctaaccttgcattgatgcaataatatataaatttatcgacaattttaacacctttg |
1139556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 163 - 206
Target Start/End: Complemental strand, 32618034 - 32617991
Alignment:
| Q |
163 |
attctcttttgaattttaagatgattttattcatatcacaaata |
206 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | |||||||||| |
|
|
| T |
32618034 |
attctcttttgaattttaagatgattatatttagatcacaaata |
32617991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 14604880 - 14604920
Alignment:
| Q |
163 |
attctcttttgaattttaagatgattttattcatatcacaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | ||||||| |
|
|
| T |
14604880 |
attctcttttgaattttaagatgattatatttagatcacaa |
14604920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University