View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10881_low_10 (Length: 304)
Name: NF10881_low_10
Description: NF10881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10881_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 13 - 292
Target Start/End: Complemental strand, 30590495 - 30590217
Alignment:
| Q |
13 |
gagaagcagagatacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatg |
112 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590495 |
gagaaacaaagatacaaaaccagagtggttgagaaatctcttggagaagaagctggaattaaatctgccaccatcgaagttgaaggccgttatgcgtatg |
30590396 |
T |
|
| Q |
113 |
ggtatttgtctggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590395 |
ggtatttgtctggggagaaaggaacacatcgcattgttcggcagtccccttttaattccaaaggtcttcgtcaggtaacaaccgactctttttgctagct |
30590296 |
T |
|
| Q |
213 |
gaatgtcagattgcttgatcagttcccnnnnnnntcccagtgaaagtgctgctgtagactgcaatagcaatgatgtccat |
292 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30590295 |
gaatgtcagattgcttgatcagttcccaaaaaaa-cccagtgaaagtgctgctgtagactgcaatagcaatgatgtccat |
30590217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University