View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10881_low_20 (Length: 250)
Name: NF10881_low_20
Description: NF10881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10881_low_20 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 12)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 98 - 236
Target Start/End: Original strand, 33010882 - 33011020
Alignment:
| Q |
98 |
atagtacacatatcatgtcagtagtcagtcaagtcagttgagaaagcgagaattgtgccgtgagaccgaaaacctttgaggtattctcaacatggcggaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33010882 |
atagtacacatatcatgtcagtagtcagtcaagtcagttgagaaagcgagaattgtgccgtgagaccgaaaacctttgaggtattctcaacatggcggaa |
33010981 |
T |
 |
| Q |
198 |
aataacaaacctgaagaagaacccttcttcctcaccctt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33010982 |
aataacaaacctgaagaagaacccttcttcctcaccctt |
33011020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 11334414 - 11334323
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggttnnnnnnn-gtttcccatggtgggaaatgattcacctttcccatatgaaatgtcac |
91 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| ||||||||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
11334414 |
tatagtaagattagtgttcccttttaatctaatggttaaaaaaaagtttcccatagtgggaaaggattcacctttcctatatgaaatgtcac |
11334323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 101
Target Start/End: Original strand, 48091135 - 48091190
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccataaaatag |
101 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |||| ||||||| |
|
|
| T |
48091135 |
tttcccatggtgggaaaagattaacctttcccatatgaaatgccacctaaaaatag |
48091190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 199266 - 199314
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccat |
94 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||||| |
|
|
| T |
199266 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccaccat |
199314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 388799 - 388753
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
388799 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccacc |
388753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 3220563 - 3220517
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||| ||| ||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
3220563 |
tttcctatgatgggaaaggattcacctttcccatataaaatgtcacc |
3220517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 35428240 - 35428286
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
35428240 |
tttcccatggtgggaaaggattaacctttcccatctgaaatgccacc |
35428286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 92
Target Start/End: Original strand, 39862887 - 39862929
Alignment:
| Q |
50 |
ccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
39862887 |
ccatggtgggaaaagattcctctttcccatatgaaatgtcacc |
39862929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 84
Target Start/End: Complemental strand, 52869493 - 52869455
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaa |
84 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
52869493 |
tttcccatggtgggaaaggattcacctttcccatgtgaa |
52869455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 50 - 95
Target Start/End: Complemental strand, 33569762 - 33569717
Alignment:
| Q |
50 |
ccatggtgggaaatgattcacctttcccatatgaaatgtcaccata |
95 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||||| ||||||| |
|
|
| T |
33569762 |
ccatggtgggaaaggattgacctttcccatgtgaaatgccaccata |
33569717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 33758081 - 33758117
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggtt |
37 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
33758081 |
tataataatatcagtgttcccttttaatctgatggtt |
33758117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 37275180 - 37275144
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggtt |
37 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
37275180 |
tatagtaagatcaatgttcccttttaatctaatggtt |
37275144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 43743796 - 43743888
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggttnnnnnnn-gtttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
43743796 |
tatagtaagatcaatgttccctttaaatctgatggttaaaaaaaagtttcccatggtgggaaaggattcacctttcccatgtgaaatgtcacc |
43743888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 46 - 84
Target Start/End: Original strand, 39477365 - 39477403
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaa |
84 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39477365 |
tttcccatggtgggaaatgattaacctttcccatatgaa |
39477403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 95
Target Start/End: Complemental strand, 9224312 - 9224263
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccata |
95 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| ||||||| |
|
|
| T |
9224312 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccaccata |
9224263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 95
Target Start/End: Original strand, 18950535 - 18950584
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccata |
95 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||| ||||||| |
|
|
| T |
18950535 |
tttcccatggtgggaaaggattaaccttttccatatgaaatgccaccata |
18950584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 4387000 - 4387046
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
4387000 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccacc |
4387046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 12206834 - 12206788
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
12206834 |
tttctcatggtgggaaaggattaacctttcccatgtgaaatgtcacc |
12206788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 16571164 - 16571118
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
16571164 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatggcacc |
16571118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 79
Target Start/End: Original strand, 14565214 - 14565247
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccat |
79 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
14565214 |
tttcccatggtgggaaaggattcacctttcccat |
14565247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 50 - 99
Target Start/End: Original strand, 20244215 - 20244264
Alignment:
| Q |
50 |
ccatggtgggaaatgattcacctttcccatatgaaatgtcaccataaaat |
99 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||||| |||||| |||| |
|
|
| T |
20244215 |
ccatggtgggaaaggattaacctttcccatgtgaaatgccaccatcaaat |
20244264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 32079112 - 32079019
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggtt--nnnnnnngtttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||| ||| |||||||||||||||| ||||||| |||| |
|
|
| T |
32079112 |
tatagtaagatcagtgttcccttttaatctgatggttaaaaaaaaagtttttcatggtggaaaaggattcacctttcccatgtgaaatgccacc |
32079019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 33668267 - 33668221
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
33668267 |
tttcccatggtgggaaatgattaacctttcccatgtgaaatgccacc |
33668221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 13936680 - 13936728
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccat |
94 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||||| |
|
|
| T |
13936680 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatggcaccat |
13936728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 11)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 93
Target Start/End: Complemental strand, 35237305 - 35237258
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacca |
93 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
35237305 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgtcacca |
35237258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 11999120 - 11999166
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
11999120 |
tttcccatggtgggaaatgattaacctttcccatgtgaaatgccacc |
11999166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 95
Target Start/End: Original strand, 4375032 - 4375081
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccata |
95 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
4375032 |
tttctcatggtggaaaatgattcatctttcccatatgaaatgccaccata |
4375081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Complemental strand, 16889241 - 16889194
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacca |
93 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| ||||| |
|
|
| T |
16889241 |
tttcccatggtgggaaaagattaacctttcccatgtgaaatgccacca |
16889194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 7818520 - 7818474
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
7818520 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccacc |
7818474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 84
Target Start/End: Complemental strand, 11998502 - 11998464
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaa |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
11998502 |
tttcccatggtgggaaatgattaacctttcccatgtgaa |
11998464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 33114228 - 33114274
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
33114228 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccacc |
33114274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 39852200 - 39852154
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
39852200 |
tttcccatggtgggaaaggattaacctttcccatttgaaatgccacc |
39852154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 43433857 - 43433811
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||||| |||| |
|
|
| T |
43433857 |
tttcccatggtgggaaatgattcccctttcccatgttaaatgccacc |
43433811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 43591656 - 43591702
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||| |||| |
|
|
| T |
43591656 |
tttcccatggtgggaaataattaacctttcccatgtgaaatgacacc |
43591702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 41761843 - 41761799
Alignment:
| Q |
48 |
tcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||| |||| |
|
|
| T |
41761843 |
tcccatggtgggaaaggattaacctttcccatgtgaaatgccacc |
41761799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 93
Target Start/End: Original strand, 39149471 - 39149518
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacca |
93 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
39149471 |
tttcccatggtgggaaaggattcacctttcccatgtgaaatgccacca |
39149518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 3957546 - 3957498
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccat |
94 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| |||||| |
|
|
| T |
3957546 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccaccat |
3957498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 28076009 - 28076055
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||| |||||||| |||||| |||| |||||||||||| |
|
|
| T |
28076009 |
tttcccatggtggaaaatgattaaccttttccatgtgaaatgtcacc |
28076055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 2458310 - 2458346
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggtt |
37 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
2458310 |
tatagtaagatcaatgttcccttttaatctaatggtt |
2458346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.00000000009; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 46 - 92
Target Start/End: Complemental strand, 36682881 - 36682835
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
36682881 |
tttcccatggtgggaaatgattaacctttcccatgtgaaatgccacc |
36682835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 47 - 92
Target Start/End: Original strand, 23283883 - 23283928
Alignment:
| Q |
47 |
ttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| |||||||||||| |
|
|
| T |
23283883 |
ttcccatggtgggaaaggattcccctttcccatgtgaaatgtcacc |
23283928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 99
Target Start/End: Complemental strand, 27855612 - 27855559
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccataaaat |
99 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||| ||||||| |||| |||||| |
|
|
| T |
27855612 |
tttctcatggtgggaaatgattaacctttcccatgtgaaatgccaccttaaaat |
27855559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 92
Target Start/End: Original strand, 85093 - 85135
Alignment:
| Q |
50 |
ccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
85093 |
ccatggtgggaaaggattcacctttcccatgtgaaatgccacc |
85135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 79
Target Start/End: Complemental strand, 4270222 - 4270189
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccat |
79 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
4270222 |
tttcccatggtgggaaaggattcacctttcccat |
4270189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 87
Target Start/End: Original strand, 4895122 - 4895163
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatg |
87 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
4895122 |
tttcccatggtggaaaatgattaacctttcccatgtgaaatg |
4895163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 87
Target Start/End: Original strand, 19816932 - 19816973
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatg |
87 |
Q |
| |
|
||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
19816932 |
tttcccatggtggaaaaggattaacctttcccatatgaaatg |
19816973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 92
Target Start/End: Complemental strand, 19767918 - 19767878
Alignment:
| Q |
52 |
atggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
19767918 |
atggtgggaaaggattaaactttcccatatgaaatgtcacc |
19767878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 94
Target Start/End: Original strand, 30422783 - 30422830
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccat |
94 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
30422783 |
tttctcatggtgggaaa-gattcacctttcccatgtgaaatgccaccat |
30422830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 94
Target Start/End: Complemental strand, 90661 - 90613
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcaccat |
94 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||| ||||||| |||||| |
|
|
| T |
90661 |
tttcctatggtggaaaatgattcacctttcccatgtgaaatgccaccat |
90613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 93
Target Start/End: Complemental strand, 3944941 - 3944894
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacca |
93 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| ||||| |
|
|
| T |
3944941 |
tttcccatggtgggaaaggattaacctttcccatgtgaaatgccacca |
3944894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 84
Target Start/End: Complemental strand, 38279455 - 38279417
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaa |
84 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
38279455 |
tttcccatggtgggaaaggattcacctttcccatgtgaa |
38279417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 50687748 - 50687794
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
50687748 |
tttcccatggtgggaaagaattaacctttcccatgtgaaatgtcacc |
50687794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 92
Target Start/End: Original strand, 53269392 - 53269434
Alignment:
| Q |
50 |
ccatggtgggaaatgattcacctttcccatatgaaatgtcacc |
92 |
Q |
| |
|
||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
53269392 |
ccatggtgggaaaggattaacctttcccatgtgaaatgtcacc |
53269434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 21811971 - 21811935
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggtt |
37 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
21811971 |
tatagtaagatcaatgttcccttttaatctaatggtt |
21811935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 37105033 - 37105069
Alignment:
| Q |
1 |
tatagtaagatcagtgttcccttttaatctgatggtt |
37 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
37105033 |
tatagtaagatcaatgttcccttttaatctaatggtt |
37105069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 86
Target Start/End: Original strand, 43352828 - 43352868
Alignment:
| Q |
46 |
tttcccatggtgggaaatgattcacctttcccatatgaaat |
86 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
43352828 |
tttcctatggtggaaaaggattcacctttcccatatgaaat |
43352868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University