View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10881_low_23 (Length: 247)
Name: NF10881_low_23
Description: NF10881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10881_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 35 - 239
Target Start/End: Original strand, 2354668 - 2354872
Alignment:
| Q |
35 |
ggatggactatgtcacgactcacgatatttcaaaaacaaaattcgacatcaacattgcatgtatatgtgatctacgattttaatattttttctctcattc |
134 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2354668 |
ggatggactatgtcacaactcacgatatttcaaaaacaaaattcgacatcaacattgcatgtatatgtgatctacgattttcatattttttctctcattc |
2354767 |
T |
|
| Q |
135 |
agcaatttttacaccacacattctaattatattttatacaatgtcaaatatgatatttgacttatgtacttatatatggttttcgattttaatcatgttc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2354768 |
agcaatttttacaccacacattctaattatattttatacaatgtcaaatatgatatttgacttatgtacttatatattgttttcgattttaatcatgttc |
2354867 |
T |
|
| Q |
235 |
tctct |
239 |
Q |
| |
|
||||| |
|
|
| T |
2354868 |
tctct |
2354872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University