View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10881_low_24 (Length: 245)
Name: NF10881_low_24
Description: NF10881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10881_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 46931876 - 46931655
Alignment:
| Q |
1 |
atgttgcaaccttaggagaaggtgggtcaattgatgttggtgcaacgttgaccgatcgatatggtcttgctccagctgatctgcttctctccaacgtgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46931876 |
atgttgcaaccttaggagaaggtgggtcaattgatgttggtgcaacgttgaccgatcgatatggtcttgctccagctgatctgcttctctccaacgtacc |
46931777 |
T |
 |
| Q |
101 |
agttgatgcactctcttgttctagttgattctgattcaaaccagacaagaatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46931776 |
agttgatgcactctcttgttctagttgattctgattcaaaccagacaagaatttatcatcccaaaccaatcctgatgaaccttgtctcctgaatgatgct |
46931677 |
T |
 |
| Q |
201 |
aatgatttctgcagctcagcca |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46931676 |
aatgatttctgcagctcagcca |
46931655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 197
Target Start/End: Complemental strand, 44510360 - 44510317
Alignment:
| Q |
154 |
tatcatcccaaaccaatcctgatgaaccttgtctcctgaatgat |
197 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| ||||||||| |
|
|
| T |
44510360 |
tatcatcccaaacaaaccctgatgaaccttgtcttctgaatgat |
44510317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University